SciELO - Scientific Electronic Library Online

 
vol.60 issue3Selection of perching site background color by Hamadryas feronia (Lepidoptera: Nymphalidae) in Costa Rica: Implications for industrial melanismGeometric wing morphometrics for Chrysomya albiceps and C. megacephala identification (Diptera: Calliphoridae) from Venezuela author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Revista de Biología Tropical

On-line version ISSN 0034-7744

Rev. biol. trop vol.60 n.3 San José Sep. 2012

 

Aproximación a la filogenia de Spodoptera (Lepidoptera: Noctuidae) con el uso de un fragmento del gen de la citocromo oxidasa I (COI)

Clara Inés Saldamando1*, 2* & Edna Judith Marquez1, 3*

*Dirección para correspondencia


Abstract
 
Approach to Spodoptera (Lepidoptera: Noctuidae) phylogeny based on  the sequence of the cytocrhome oxydase I (COI) mitochondrial gene. The genus Spodoptera includes 30 species of moths considered important pests worldwide, with a great representation in the Western Hemisphere. In general, Noctuidae species have morphological similarities that have caused some difficulties for assertive species identification by conventional methods. The purpose of this work was to generate an approach to the genus phylogeny from several species of the genus Spodoptera and the species Bombyx mori as an out group, with the use of molecular tools. For this, a total of 102 S. frugiperda larvae were obtained at random in corn, cotton, rice, grass and sorghum, during late 2006 and early 2009, from Colombia. We took ADN samples from the larval posterior part and we analyzed a fragment of 451 base pairs of the mitochondrial gene cytochrome oxydase I (COI), to produce a maximum likelihood  (ML) tree by using 62 sequences (29 Colombian haplotypes were used). Our results showed a great genetic differentiation (K2 distances) amongst S. frugiperda haplotypes from Colombia and the United States, condition supported by the estimators obtained for haplotype diversity and polymorphism. The obtained ML tree clustered most of the species with bootstrapping values from 73-99% in the interior branches; with low values also observed in some of the branches. In addition, this tree clustered two species of the Eastern hemisphere (S. littoralis and S. litura) and eight species of the Western hemisphere (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli and S. pulchella). In Colombia, S. frugiperda, S. ornithogalli and S. albula represent a group of species referred as “the Spodoptera complex” of cotton crops, and our work demonstrated that sequencing a fragment of the COI gene, allows researchers to differentiate the first two species, and thus it can be used as an alternative method to taxonomic keys based on morphology. Finally, the ML tree did not cluster S. frugiperda with S. ornithogalli, suggesting that both species do not share the same recent ancestral even though they coexist in cotton. We suggest sequencing other genes (mitochondrial and nuclear) to increase our understanding of this genus evolution.

Key words: phylogeny, Spodoptera, cryptic species, gene COI.

Resumen

En este trabajo se secuenció un fragmento de 451pb del gen mitocondrial de la citocromo oxidasa I (COI) en 62 secuencias del género Spodoptera y una secuencia de Bombix mori  (grupo externo). Los resultados mostraron  gran diferenciación genética (distancia K2) entre los haplotipos de Spodoptera frugiperda de Colombia y Estados Unidos, según los estimadores de diversidad haplotípica, diversidad y polimorfismo nucleotídicos calculados. Un árbol de ML agrupó las especies con valores de bootstrap entre 73-99% en las ramas internas. No obstante algunas ramas presentaron bajos valores de bootstrap. Este árbol formó un grupo constituido por las especies del hemisferio oriental (S. littoralis y S. litura) y también agrupó las especies localizadas en el  hemisferio occidental (S. androgea, S.  dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli y S. pulchella). Esto demuestra que el árbol agrupó las especies con base en su origen geográfico. Contrariamente, el árbol no agrupó a S.  frugiperda con S. ornithogalli, demostrando que a pesar de que ambas coexisten en el cultivo de algodón, no comparten un ancestro común reciente. En Colombia, estas especies  forman parte del “complejo Spodoptera” del algodón, y nuestros resultados demuestran que la secuenciación de este gen permite diferenciarlas sin necesidad del uso de claves  taxonómicas de sus estadios larvales. Este trabajo es una aproximación a la filogenia de este género, por lo cual la inclusión de más genes (mitocondriales y nucleares) son necesarios para futuros trabajos.

Palabras clave: filogenia, Spodoptera, especies crípticas, gen COI.



El género Spodoptera Guenee, 1852 (Noctuidae: Amphipyrinae) está compuesto por un grupo de especies de polillas consideradas plagas de gran impacto económico, ya que se alimentan de cultivos de maíz, algodón, sorgo, arroz, pastos y maní, entre otros (Passoa 1991, Pogue  2002).  La mayoría  de  sus  especies, se encuentran distribuidas en el hemisferio occidental  (Pogue  2002),  aunque  algunas de ellas se encuentran en el hemisferio oriental (Heppner 1998). Entre las especies más conocidas en el continente Americano se encuentran: Spodoptera frugiperda (J.E. Smith), S. ornithogalli (Guenee), S. albula (Walker), S. exigua (Hübner), S. eridania (Stoll), S. androgea (Stoll), S. latifascia (Walker), S. dolichos (Fabricius), S. pulchella (Herrich-Schäffer), y en África y el Mediterráneo las especies: S. litura (Fabricius) y S. littoralis (Boisduval) (Brown & Dewhurst 1975). Todas estas polillas han sido reconocidas por representar “especies crípticas”, debido a que su morfología externa es muy similar a nivel de la larva y el adulto. Por ejemplo, S. frugiperda, S. ornithogalli y S. albula son especies crípticas reconocidas como el complejo Spodoptera del cultivo de algodón (Santos-Amaya et al. 2009) dada la gran similitud morfológica de sus larvas en sus primeros estadíos larvales y representan especies simpátricas en el departamento del Tolima en Colombia.

Las  especies  de  la  familia  Noctuidae, entre las que se incluyen especies del género Spodoptera, se caracterizan por presentar dificultad en la identificación bien sea por medio de caracteres morfológicos con el uso de su morfología (Yela & Kitching 1999) y/o su composición molecular (Wagner 2001, Mitchell et al. 2006). Por ello, su evolución no ha presentado una divergencia bien establecida. Muchas de estas especies pueden compartir haplotipos plesiomórficos o ancestrales ya que todavía no han tenido suficiente tiempo evolutivo para generar mutaciones autapomórficas (Mitchell et al. 2006).

Uno de los trabajos más recientes sobre la filogenia de la superfamilia Noctuidae fue realizado por Mitchell et al. (2006). En este trabajo,  los  autores  utilizaron  secuencias  de dos genes nucleares: el factor de elongación (EF-1α, un fragmento de 1 200 [base pairs] bp) y la dopa decarboxilasa (DDC, un fragmento entre 700-1 100 [base pairs] bp), con el fin de establecer las relaciones filogenéticas de las familias  de  los  nóctuidos.  Ellos  encontraron que la mayoría de las ramas del árbol construido con el algoritmo de máxima verosimilitud (ML) tenían valores de bootsraping entre 50-80% de soporte. Este árbol se afectó por la ubicación de la familia Noctuidae como grupo parafilético de las familias Arctiidae y Lymantriidae  y  todas  las  familias  quadrifinas  (las cuales presentan este tipo de venación, vena MA2, en las alas posteriores). Por otro lado, un trabajo sobre la filogenia de los nóctuidos basada en la morfología de adultos y larvas de esta superfamilia realizado por Yela & Kitching (1999) también generó agrupaciones con problemas en el establecimiento de las relaciones monofiléticas para los nóctuidos. Estos autores, al igual que Mitchell et al. (2006) argumentan que una de las dificultades en establecer la filogenia de esta familia, es la gran cantidad de especies existentes en la misma, debido a que tiene alrededor de 25 000 (Wagner 2001). Además, estas especies tienen una gran disparidad morfológica y gran homogeneidad en cuanto su patrón básico de reconocimiento, produciendo muchas homoplasias. Yela & Kitching (1999) concluyen en su trabajo que para mejorar el análisis filogenético de esta familia, se requiere el uso de caracteres morfológicos de sus larvas y adultos, en conjunto con el uso de marcadores moleculares y de la historia de vida (biología). Estos autores además, apoyan la importancia de establecer la filogenia de estas polillas, dada su relevancia dentro de un contexto ecológico (por  su  gran  diversidad)  y  uno  agronómico (por  ser  plagas  importantes  de  cultivos).  La idea  de Yela  &  Kitching  (1999)  también  es apoyada por Mitchell et al. (2006) ya que ellos enfatizan la necesidad de esclarecer la filogenia  de  este  grupo  combinando  herramientas de la morfología y de la biología molecular particularmente porque ellos encontraron que la asociación de estas polillas hacia su planta hospedera tiene una relación latitudinal, lo cual se puede analizar a gran escala con el uso de herramientas moleculares.

Dada la importancia de la biología molecular como apoyo para mejorar el esclarecimiento de las relaciones filogenéticas de los nóctuidos, y en particular de las relaciones ancestro descendiente de Spodoptera sp., el objetivo de este estudio fue realizar una filogenia de algunas especies del género Spodoptera con el uso de la secuenciación de un fragmento del gen de la citocromo oxidasa I (COI) como una primera aproximación del establecimiento de las relaciones filogenéticas existentes entre las especies de este género que ya han sido secuenciadas para este gen y cuya base de datos se encuentra en el Genbank. El uso del gen COI en este trabajo presenta varias ventajas dentro de las cuales se encuentran (Freeland 2005): a) el ADN mitocondrial es fácil de aislar, dada su alta abundancia en las células, b) este ADN presenta herencia materna y por lo tanto ausencia de recombinación que permite establecer una historia evolutiva del grupo taxonómico a estudiar, c) tiene altas tasas de mutación en diferentes partes de la molécula, d) la respiración celular ha sido muy estudiada y por lo tanto la actividad del gen COI muy conocida, e) su estructura y tamaño es muy conservada en todos los organismos aeróbicos, f) este ADN presenta regiones altamente conservadas seguidas de unas regiones altamente variables que permiten estudiar la diferenciación genética entre poblaciones de una misma especie y entre especies de un mismo género, y g) tiene gran aplicabilidad en una gran cantidad de insectos (Lunt et al. 1996, Freeland 2005). Sin embargo, para llevar a cabo un estudio filogenético de un grupo, lo ideal es utilizar secuencias de varios genes mitocondriales y nucleares, debido a que en muchos casos la interpretación de la evolución de un grupo taxonómico puede ser afectada más por la tasa evolutiva del gen analizado, que por la evolución real de este grupo (Freeland 2005) y muchos de los trabajos en insectos y particularmente, Lepidopteros tienen en cuenta el gen nuclear del factor de elongación  y  los  genes  mitocondriales  COI y COII para el establecimiento de filogenias en lepidopteros. Ejemplos de esto son: las polillas del género Copitarsia (Lepidoptera: Noctuidae) (Pogue & Simmons 2008), las mariposas del género Byclyclus (Kirby 1871) (Monteiro & Pierce 2001), de las polillas del género Eois (Geometridae) (Strutzenberger et al. 2010) entre otras especies. Por esta razón, los resultados obtenidos en este estudio deben ser vistos como una aproximación, más que como una resolución total de las relaciones evolutivas de algunas de las especies de Spodoptera, puesto que presentan gran similitud morfológica, pero diferenciación genética entre ellas (Mitchell et al. 2006).

Materiales y métodos

Área de estudio y recolectas: Un total de 1 652 larvas de S. frugiperda fueron recolectadas al azar en cultivos de maíz, algodón, arroz, pasto y sorgo, a finales del 2006 y principios del 2009, en los departamentos de Tolima, Córdoba, Meta, Antioquia y Valle del Cauca en Colombia para el desarrollo de análisis de estructura poblacional del insecto en Colombia. Las recolectas se hicieron de larvas y no de adultos, debido a que se deseaba determinar si los haplotipos de S. frugiperda presentaban algún tipo de asociación con estos cultivos.

Una vez recolectadas, las larvas fueron almacenadas  en  tubos  de  plástico  de  1.5mL con etanol al 70%, etiquetados con el lugar de recolección y planta hospedera, y enviadas al laboratorio de Biotecnología Vegetal UNALMED-CIB (Corporación para Investigaciones Biológicas) en donde fueron almacenadas al vacío a -70ºC hasta su procesamiento. De estas larvas,  Salinas  (2010)  identificó  un  10%  de sus  individuos  con  el  uso  de  las  claves  de Tood & Poole (1980). Dentro de algunas de las características que permitieron la correcta identificación de esta especie se encuentran la presencia de propatas desde el segmento abdominal  A3-A6,  crochets  presentes,  tres  setas en el grupo SV en la propata del segmento abdominal 6 (A6), cuerpo liso o cubierto con gránulos convexos o cónicos, espiráculo en el segmento abdominal 8 (A8) ubicado lateralmente y margen posterior del lóbulo anal convexo, no lobulado o sin tubérculos, entre otras.

Extracción de ADN mitocondrial: Un fragmento de la parte posterior de las larvas fue utilizado por Salinas (2010) para la extracción de ADN en 102 muestras, la cual se llevó a cabo con el protocolo CTAB con las modificaciones (Black & Duteau 1997) que aparecen a continuación: Cada fragmento fue homogenizado con nitrógeno líquido y depositado en un tubo eppendorf de 1.5mL, se adicionó 400µL de buffer de extracción CTAB (2X), 4µL  de β-mercaptoetanol  y  20µL  de  Proteinasa  K. Cada tubo fue incubado por 1hr a 65º C y mezclado por inversión suave cada 10min. Cada muestra fue centrifugada por 6min a 12 000rpm a 10ºC, y luego la solución fue transferida a un nuevo tubo. A cada tubo se le agregaron 500µL de  cloroformo  alcohol-isoamílico  frío  (24:1) y fue centrifugado por 30min a 12 000rpm a 10°C. El sobrenadante fue transferido a un nuevo tubo y el procedimiento se repitió con un volumen igual de cloroformo alcohol-isoamílico y fue centrifugado nuevamente por 30min a 12 000rpm a 10°C. El nuevo sobrenadante fue trasferido a un nuevo tubo, se adicionó un volumen equivalente de cloroformo frío (100%) y se centrifugó por 20min a 12 000rpm a 10°C. El  sobrenadante  resultante  fue  transferido  a otro tubo y se adicionó 400µL de isopropanol puro frío. El ADN fue precipitado por refrigeración a -20°C por 1hr y luego centrifugado por 30min a 12 000 rpm a 4°C. El sobrenadante fue eliminado y el pellet fue lavado con 500µL de etanol frío (100%) y centrifugado por 6min a 12 000rpm a 4°C; este procedimiento se repitió y el pellet fue secado a temperatura ambiente y resuspendido en 50µL de buffer TE (1X) (TRIS HCL 100mM y EDTA 10mM, pH 8.0). Finalmente, el RNA fue removido adicionando 1mL de RNasa e incubando a 37°C por 1hr.

Amplificación y secuenciación del gen citocromo oxidasa I-COI: La amplificación por PCR del gen COI fue realizada por Salinas (2010) en una mezcla de reacción de 50µL que contenía 5µL de buffer de PCR, 3µL de MgCl2, 1µL de dNTPs, 2µL del cebador sentido, 2µL del cebador contra sentido y 1µL de Taq polimerasa. El programa de amplificación en termociclador fue: 94ºC (3min), seguido de 30 ciclos de 94ºC (1min) 59ºC (1min), 72ºC (1min), y un segmento final de extensión de 72ºC por 10min (My Cycler Termal Cycler, Biorad). La amplificación del COI se llevo a cabo con el par de cebadores JM76 F (5’GAGCTGAATTAGGRACTCCAGG3’) y COI 1483 R  5’GCTGGTGGTAAATTTTGATAT3’) (Invitrogen). Cada producto amplificado fue visualizado en una cámara de electroforesis en un gel de agarosa al 1% con 2.0µL de bromuro de etidio. Las muestras fueron enviadas a Macrogen Inc. (Corea del Sur)  para su posterior purificación y secuenciación.
    
Análisis de secuencias: El Genbank tiene almacenadas 105 secuencias del género Spodoptera de un fragmento del gen de la citocromo oxidasa I (COI), sin embargo 34 fueron tomadas en cuenta en este trabajo (Cuadro 1), debido a que muchas representaban un mismo haplotipo de una especie. A estas se le adicionaron 29 secuencias de S. frugiperda de Colombia que representaron haplotipos diferentes de la especie, identificados con la distancia genética de Kimura dos parámetros (α=transisiones y β=transversiones) (Nei & Kummar 2000). Estas 62 secuencias fueron tenidas en cuenta para establecer el grupo interno del árbol filogenético  y  como  grupo  externo  se  tomó la secuencia del gen COI del gusano de seda Bombix mori (Lepidoptera: Bombiycidae).

Todas las secuencias fueron editadas a mano con Bioedit (Hall 1999) y alineadas con el  algoritmo  Clustal W (Larkin  et  al.  2007, Chenna et al. 2003) en el programa Mega 5.0 (Tamura et al. 2011). Adicionalmente, el modelo de evolución nucleotídica también fue obtenido con este programa. El nivel de entropía de la secuencia, fue evaluado con Bioedit (Hall 1999). Este estimador fue utilizado para determinar si la variación nucleotídica del fragmento del gen COI era constante. Las comparaciones de las secuencias de ADN que incluyeron la identificación de los haplotipos (H), sitios polimorficos (p=lugares en la secuencia en la que ocurrió el polimorfismo), sitios segregantes (s=número de sitios variables en todo un grupo de secuencias), diversidad nucleotídica П=π/L, π=promedio de las diferencias nucleotídicas entre dos secuencias elegidas al azar de una población,  L=longitud  de  la  secuencia  (Nei & Li 1979), polimorfismo nucleotídico θ=s/α número  de  sitios  nucleotídicos  segregantes “s” en una muestra de “α” número de secuencias (Watterson 1975) y test de neutralidad de DTajima=π-(s/α/(V([π–(s/α)])   (Tajima  1989) fueron estimadores obtenidos con el programa DNAsp V5 (Librado & Rozas 2009). Un árbol de genes fue obtenido con las 63 secuencias mediante el uso del algoritmo de máxima verosimilitud (ML) (Guindon & Gascuel 2003) con  el  programa  Mega  5.0.  Este  algoritmo fue  escogido  debido  a  que  representa  uno de los métodos más robustos para establecer topologías  de  árboles,  ya  que  dentro  de  sus funciones está encontrar la mejor longitud de las ramas del árbol, teniendo en cuenta: 1) la probabilidad anterior de que un nodo “0” del árbol tenga el nucleótido “xogxo” relativo a la frecuencia con la que se encuentra este nucleótido “gxo” en todas las secuencias analizadas,  2) la probabilidad Pij(t) de que el nucleótido “i” mute al nucleótido “j” en un tiempo “t”, y 3) la tasa de evolución de sustituciones nuleotídicas esperadas v=4rt, siendo r=tasa de sustitución nucleotídica y t=tiempo evolutivo, por lo que la función de la longitud de la rama es lk=giPij(v) y al sumar todas las ramas del árbol para obtener su topología, se obtendría la  función  de  verosimilitud  lnL=∑lnLk  (Nei& Kumar 2000). Este arbol de ML se utilizó para visualizar la similitud genética entre las secuencias de S. frugiperda de cada uno de los haplotipos encontrados en Colombia y las secuencias de las demás especies del género Spodoptera después de la realización de 500 bootstraps (Felsestein 1985) para asegurar la topología del árbol ML.

Resultados

Los resultados sobre la entropía de un fragmento de 451 pares de bases del gen de la citocromo oxidada I (COI) mostró que su variación nucleotídica es confiable según la grafica (Entropía vs Posición de alineamiento) que arrojó el programa Bioedit ya que la variación de la entropía en todas las secuencias permaneció en rangos de valores de entropía muy similares. Por otro lado, el polimorfismo nulceotídico y demás estimadores relacionados con la variación genética en este fragmento, mostraron en general que la combinación de las secuencias de S. frugiperda de Colombia con las secuencias de otras polillas del mismo género de Estados Unidos, África y Europa produjo un aumento en el número de haplotipos, y también un aumento en la diversidad de haplotipos (Cuadro 2). Otro estimador que presentó grandes diferencias genéticas entre OTUS fue el de la diversidad nucleotídica (Π) (Cuadro 1). La inclusión de secuencias de S. frugiperda de Colombia junto con las demás del género produjo un aumento del estimador de  diversidad  nucleotídica,  demostrando  que las poblaciones colombianas de S. frugiperda presentan una gran diferenciación genética no solamente  con  haplotipos  de  otras  especies del mismo género, sino también con secuencias de la misma especie recolectadas en los Estados Unidos (Cuadro 2). Esto último se corrobora con un análisis de distancias genéticas de Kimura 2 parámetros, realizado entre los haplotipos de S. frugiperda de Colombia y Estados Unidos, ya que las distancias entre Colombia y Estados Unidos alcanzaron valores de 1.0721±0.0181, mientras que las distancias genéticas de los haplotipos dentro de Colombia tuvieron valores cercanos a 0.3107±0.4959 y las distancias promedio de Estados Unidos y Colombia, valores cercanos a 0.4953±0.5425.

Por otro lado, el árbol de ML obtenido, se produjo después de analizar el modelo de sustitución nucleotídica en 62 secuencias. El modelo de sustitución que se ajustó a la evolución del gen COI en estas secuencias fue GTR+G (BIC=8 668, 286, lnL=-2 767. 177). La  frecuencia  promedio  de  los  nucleótidos de las secuencias fue de A=0.338, C=0.140, G=0.119 y T=0.354, siendo en este caso A y T las bases más frecuentes en estas secuencias, como se ha encontrado en otros insectos (Lunt et al. 1996, Freeland 2005). Este árbol agrupó el 86% de las secuencias de S. frugiperda de Colombia en un mismo clado con un bootstrap de 100%, lo cual asegura que éstos haplotipos se unieron entre si dada su gran similitud genética (Fig. 1). Este grupo se encuentra conformado por secuencias de haplotipos del insecto recolectado en cultivos de maíz, algodón, sorgo y arroz en cinco departamentos colombianos, y su agrupación refleja una asociación del haplotipo a su planta hospedera. Esto debido a que la mayoría de haplotipos de los insectos recolectados en algodón se encuentran más cercanos entre sí indistintamente del departamento del  cual  provienen. Además,  algunos  de  los haplotipos recolectados en maíz, agruparon a los haplotipos de algodón, y los haplotipos del Tolima recolectados en arroz y sorgo se agruparon entre sí. El énfasis dado a tales cultivos en este trabajo se produjo, ya que en investigaciones previas se demostró la presencia de dos biotipos de S. frugiperda en el Tolima. El biotipo de maíz, fue más frecuentemente encontrado en cultivos de maíz, algodón y sorgo, y el biotipo de arroz, más abundantemente en cultivos de arroz. Adicionalmente, las secuencias de S. frugiperda que se agruparon en otra parte del árbol ML, formaron un grupo compuesto por secuencias de Tolima, Meta y Antioquia en conjunto con secuencias de S. frugiperda de los Estados Unidos. Estas agrupaciones se produjeron entre secuencias provenientes del mismo cultivo, ya que las secuencias de Estados Unidos con símbolos CS (corn strain=biotipo de maíz) se unieron a secuencias colombianas del insecto recolectadas en maíz y de la misma manera, secuencias de Estados Unidos con símbolos RS (rice strain=biotipo de arroz) se unieron a secuencias colombianas del insecto recolectadas en arroz.

Discusión

Dadas las altas estimaciones de las distancias genéticas obtenidas para las especies del género Spodoptera y en particular entre los OTUS de S. frugiperda de Colombia y Estados Unidos obtenidos en este trabajo, se sugiere que ambos OUTS de los dos países son diferentes especies (dada la evidencia molecular). Estos resultados se corroboran con el hecho de que valores altos de distancias genéticas de Nei (que asumen neutralidad en el gen y tasa de sustitución nucleotídica Jukes y Cantor de ¼) entre diferentes especies de moscas de la fruta del género Drosophila han sido utilizadas por Coyne & Orr (1998) para comparar estas distancias con el nivel de aislamiento reproductivo entre sus especies. Coyne & Orr (1998) encontraron que las especies verdaderas  (reconocidas  con  el  concepto  biológico de especie) presentan distancias genéticas mayores o iguales a 0.5. Igualmente, valores de distancias genéticas de Nei entre 0.49-0.87 fueron valores representativos para establecer la diferenciación genética de dos especies de mariposas del género Heliconius sp. (Jiggins & Davies 1998), por lo que las distancias K2 obtenidas para los haplotipos de S. frugiperda de Colombia y Estados Unidos son mucho más altos comparados con estas especies de mariposas neotropicales y con las distancias genéticas encontradas para Drosophila sp.

Adicionalmente, las agrupaciones formadas entre algunas secuencias de S. frugiperda colombianas  con  secuencias  de  esta  especie de Estados Unidos, puede reflejar la retención de polimorfismos genéticos ancestrales de los biotipos de maíz y arroz de S. frugiperda entre estas secuencias (Lunt et al. 1996, Busato et al. 2004, Prowell et al. 2004, Vélez-Arango et al. 2008). Otro caso de retención de polimorfismos ancestrales, lo presenta la polilla Ostrinia nubilalis puesto que esta divergió en dos razas asociadas al maíz (Zea mais) y artemisia (Artemisia  vulgaris)  (Martel  et  al.  2003). Ambas razas presentan polimorfismos ancestrales a nivel del gen Ldh de la aloenzima lactato deshidrogenasa, ya que estas dos razas son simpátricas, pero comparten similitudes nucleotídicas en este gen a pesar de no presentar flujo genético entre ellas en las regiones de Francia en las que fueron recolectadas (Dopman et al. 2005).

En el árbol de ML, las secuencias de Estados  Unidos  de  S.  frugiperda  recolectadas  en  cultivos  de  maíz  y  arroz  se  agruparon dependiendo del cultivo en las cuales se encontraron. Estos resultados demuestran que los haplotipos de maíz y arroz de este país, se mueven dentro de cada uno de estos cultivos y por lo tanto muestran una asociación a su planta hospedera respectiva. Este mismo resultado fue obtenido por Lewter et al. (2006) en un trabajo en el que analizaron 71 secuencias de S. frugiperda de Estados Unidos y en el que  encontraron  tres  haplotipos  exclusivos del cultivo de maíz y cuatro haplotipos exclusivos del cultivo de arroz. Los haplotipos identificados por estos últimos autores fueron utilizados en el presente trabajo para compararlos con los haplotipos de la misma especie en Colombia. Los números de accesión de las secuencias de Estados Unidos de S. frugiperda son: AY714298 (Florida, Arkansas, Misisipi y California, recolectado en maíz), AY714299 (Florida, recolectado en maíz), AY714300 (Florida, recolectado en maíz), AY714301(Florida, recolectado en arroz), AY714302 (Florida, Arkansas, recolectado en arroz), AY714303 (Florida, Arkansas, recolectado en arroz) y AY714304 (Florida, recolectado en arroz).

Por otro lado, respecto a las otras especies del genero Spodoptera analizadas en este estudio, se encontró que el árbol concenso ML agrupó haplotipos de la misma especie entre sí, por ejemplo S. eridania y sus dos haplotipos h1 y h5, S. litura y sus tres haplotipos h4, h3 y h2, S. latifascia y sus tres haplotipos SRNP, S. dolichos y sus tres haplotipos h1, h2 y h3, S. androgea y sus tres haplotipos SRNP, S. pulchella y sus dos haplotipos h1 y h2, S. ornithogalli y sus dos haplotipos HLB y S. exigua y sus cuatro haplotipos h1, h2, h3 y h4. Todas estas agrupaciones muestran que las secuencias  existentes  dentro  de  cada  especie  son más similares entre sí que con otras especies, demostrando que el árbol de ML refleja la historia evolutiva del género (valores de bootstrap dentro de cada especie variaron entre 73-99%). Este árbol también agrupó a S. frugiperda (secuencias AY) con S. exigua, por un lado y con S. eridania por el otro, estas agrupaciones tienen valores de bootstrap entre el 85-99%. Adicionalmente, el árbol ML no agrupo a S. ornithogalli  con  S.  frugiperda  demostrando que ambas especies no presentan un ancestro común reciente (con un ramaje de bootstrap de 97%). Este resultado es importante para Colombia, ya que ambas especies son morfológicamente muy similares, lo cual genera confusión cuando son recolectadas en estados larvales en cultivos de algodón en este país (Santos-Amaya et al. 2009). Los resultados obtenidos aquí comprueban que estas especies presentan gran diferenciación genética a nivel del gen COI de la mitocondria, por lo que este gen representa un buen marcador molecular y una alternativa para distinguir estas especies crípticas, particularmente cuando en sus estadios  larvales  no  se  pueden  diferenciar  estas dos especies. Es importante mencionar que en este trabajo no se analizaron secuencias de S. albula (puesto que no se encuentran disponibles en el Genbank), y esta especie también es parte del complejo Spodoptera del algodonero. Nuevos trabajos sobre secuenciación de este gen requiere su inclusión para dilucidar mejor las relaciones ancestro descendiente entre las especies de este complejo.

Por otro lado, las especies S. litura y S. littoralis se agruparon cercanamente en el árbol de ML, lo cual se esperaría dada su distribución geográfica en Europa y Asia (hemisferio oriental). Igualmente, las especies S. latifascia, S. dolichos, S. androgea y S. pulchella, se agruparon entre sí y dicha agrupación reflejo sus rangos de distribución en América (hemisferio occidental). Bombix mori se agrupó más cercanamente a S. exigua, lo cual no se esperaba en nuestros resultados, puesto que pertenece a otra familia de lepidópteros. Este resultado puede significar que este grupo externo no presenta suficiente diferenciación genética con el género Spodoptera. No obstante, el árbol de ML mostró agrupaciones de especies de este género esperadas según su filogeografía, mostrando que esta secuencia no sesgó los resultados obtenidos en este trabajo.

Adicionalmente, estimadores de polimorfismo nucleotídico calculados en S. frugiperda de Colombia muestran que las poblaciones de esta especie en este país presentan una gran diferenciación  genética  con  las  poblaciones de la misma especie en Estados Unidos. Estos estimadores corroboran las agrupaciones obtenidas con el árbol de ML. La diferenciación genética de las poblaciones de S. frugiperda es tan elevada, que cuando sus haplotipos son combinados con los haplotipos de especies del mismo género, sus valores de polimorfismo nucleotídico aumentan, al igual que sus distancias genéticas. Estos resultados demuestran que los haplotipos de S. frugiperda de Colombia podrían representar una especie diferente a los haplotipos de esta especie en Estados Unidos, esta diferenciación se da a pesar de que la capacidad de dispersión del insecto sea muy alta (Nagoshi et al. 2008, Salinas 2010). Esto significa que la diferenciación genética en esta especie esta fuertemente influenciada por una separación geográfica entre ambos países.
Los resultados obtenidos son una aproximación a las relaciones filogenéticas del género Spodoptera, por ello futuros trabajos con este grupo se deberían enfocar en analizar secuencias de otros genes mitocondriales y nucleares, además de analizar más caracteres morfológicos y de la biología de las especies de este taxon como lo sugerido por Yela & Kitching (1999). Sin embargo, el uso del gen nuclear ribosomal  rRNA y  los  genes  mitocondriales ND1 y tRNA para el análisis filogenético de la superfamilia Noctuidae realizado por Weller et al. (1994) no produjo árboles monofiléticos para este taxon, significando que la búsqueda de los caracteres morfológicos y los loci más adecuados puede ser difícil y compleja para este grupo.

Finalmente, respecto al test de neutralidad de Tajima, todas las secuencias del género Spodoptera no fueron significativas respecto a este estimador, demostrando la neutralidad del gen analizado. Esto permite sugerir que las poblaciones de estas especies no se han encontrado en estados de expansión ni reducción drásticos que afecten su variabilidad genética (Nei
& Kummar 2000).

Agradecimientos

Las  autoras  expresan  su  agradecimiento a Haidy Salinas-Hernández por el desarrollo de la parte molecular utilizada en este trabajo que hace parte de su tesis de maestría en Ciencias-Entomología. A CORTOLIMA por otorgar el permiso de captura y acceso a los recursos genéticos de S. frugiperda en Tolima (Resolución 843, agosto 2007), y al Ministerio de  Medio Ambiente  y  Desarrollo  Territorial de Colombia por el permiso de recolecta y acceso a recurso genético (4120E1-44703, 24 de Abril de 2008). Este trabajo fue financiado por la Universidad Nacional de Colombia (Código Quipu 201010007294 , 20101009540) y por Colciencias (Instituto Colombiano para la Ciencia y la Tecnología) (Contrato número: 1118-452-21042) ) (colectas de larvas). Ambos proyectos fueron otorgados a la investigadora principal Clara Saldamando.


Referencias

Black, W.C. & N.M. Duteau. 1997. RAPD-PCR and SSCP analysis  for  insect  population  genetic   studie,  p. 361-373. In J.M. Crampton, C.B. Beard & C. Louis (eds.). The molecular biology of insect disease vectors: a methods manual. Chapman & Hall, Londres, Inglaterra.         [ Links ]

Brown, E.S. & C.F. Dewhurst. 1975. The genus Spodoptera (Lepidoptera, Noctuidae) in Africa and the Near East. B. Entomol. Res. 65: 221-262.         [ Links ]

Busato,  G.R., A.D. Gruztmacher, A.C. De  Oliveira, E.A. Vieira,  P.A.  Zimmer,  M.M.  Kopp,  J.  De  Bandeira  &  T.  Magalahes.  2004.  Analise  da  estrutura  e diversidade  molecular de poblacioes de  Spodoptera frugiperda  (J.E.  Smith)   (Lepidoptera:  Noctuidae) asociadas as culturas de milho e arroz no Rio Grande do Sul. Neotrop. Entomol. 33: 709-716.         [ Links ]

Chenna, R., H. Sugawara, T. Koike, R. Lopez, J.T. Gibson, D.G.  Higgins  &  J.D.  Thompson.  2003.  Multiple sequence  alignment with the Clustal series of  programs. Nucleic Acids Res. 31: 3497-3500.         [ Links ]

Coyne,  J.A. & H.A. Orr. 1998. The  evolutionary genetics of speciation.  Philos. T. R. Soc. Lond. B. 353: 287-305.         [ Links ]

Dopman, D.B., L. Pérez, S.M. Bogdanowicz & R.G. Harrison. 2005. Consequences of reproductive barriers for genealogical discordance in the european corn borer. P. Natl. Acad. Sci. USA 102: 14 706-14 711.         [ Links ]

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791.         [ Links ]

Freeland, J. 2005. Molecular Ecology. Wiley,  Londres, Inglaterra.         [ Links ]

Guindon,  S.  &  O.  Gascuel.  2003.  A  simple,  fast  and accurate  method  to  estimate  large  phylogenies  by maximum-likelihood. Syst. Biol. 52: 696-704.         [ Links ]

Hall, T.A. 1999. Bioedit. A user friendly biological sequence aligment editor and analysis program for windows 95/98/NT. Nucl. Acid S. 41: 95-98.         [ Links ]

Heppner,  J.B.  1998.  Spodoptera  armyworms  in  Florida (Lepidoptera:  Noctuidae).   Florida  Department  of Agriculture  and   Consumer  Services,  Division  of Plant  Industry Entomological Circular 390,  Florida, Estados Unidos.         [ Links ]

Jiggins, C.D. & N. Davies. 1998. Genetic evidence for a sibling species of Heliconius charithonia (Lepidoptera; Nymphalidae). Biol. J. Linn. Soc. 64: 57-67.         [ Links ]

Larkin,  M.A., G. Blackshields, N.P. Brown,  R. Chenna, P.A. McGettigan, H.  McWilliam, F. Valentin, I.M. Wallace,  A.  Wilm, R. Lopez, J.D. Thompson,  T.J. Gibson & D.G. Higgins. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2 947-2 948.         [ Links ]

Lewter, J.A., A.L. Szalanski, R.N. Nagoshi, R.L. Meagher, C.B. Owens & R.G. Luttrell. 2006. Genetic variation within  and  between strains of the fall  armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae). Fla. Entomologist 89: 63-67.         [ Links ]

Librado, P. & J. Rozas. 2009. DnaSP V5. A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451-1452.         [ Links ]

Lunt, D.H., D.X. Zhang, J.M. Szymura & G. Hewitt. 1996. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect Mol. Biol. 5: 153-165.         [ Links ]

Martel, C., A. Rejasse, F. Rousset, M.T.  Bethenod  & D.  Bourguet.  2003.  Host  plant  associated  genetic differentiation in northern French populations of the European corn borer. Heredity 90: 141-149.         [ Links ]

Mitchell, A., C. Mitter & J.C. Regier. 2006.  Systematics and  evolution  of  the  cutworm  moths  (Lepidoptera:  Noctuidae):  evidence  from  two  protein-coding nuclear genes. Syst. Entomol. 1: 21-46.         [ Links ]

Monteiro,  A. & N.E. Pierce. 2001. Phylogeny  of Bicyclus (Lepidoptera: Nymphalidae) inferred from COI, COII,  and  EF-1a  gene  sequences.  Mol.  Phylogen. Evol. 18: 264-281.         [ Links ]

Nagoshi,  R.N., R.L. Meagher, K. Flanders, J.  Gore, R. Jackson,  J. Lopez, J.S. Armstrong, G.D.  Buntin, C. Sansone & R. Leonard. 2008.  Using haplotypes to monitor the  migration of fall armyworm (Lepidoptera: Noctuidae) corn-strain populations  from Texas and Florida. J. Econ. Entomol. 101: 742-749.         [ Links ]

Nei,  M. & S. Kummar. 2000. Molecular  evolution and phylogenetics. Oxford, Oxford, Inglaterra.         [ Links ]

Nei, M. & W.H. Li. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. P. Natl. Acad. Sci. USA 76: 5 269-5 273.         [ Links ]

Passoa, S. 1991. Color identification of  economically important Spodoptera larvae in Honduras (Lepidoptera: Noctuidae). Insecta Munda 5: 185-196.         [ Links ]

Pogue,  M.G. 2002. A world revision of the  genus Spodoptera Guenée (Lepidoptera: Noctuidae). Mem. A. Entomol. Inst. 43: 1-202.         [ Links ]

Pogue, M.G. & R.B. Simmons. 2008. A new pest species of Copitarsia (Lepidoptera: Noctuidae) from the neotropical region feeding on Asparagus and cut flowers. Ann. Entomol. Soc. Am. 101: 743-762.         [ Links ]

Prowell,  D.P., M. Mcmichael & J.F. Silvain.  2004. Multilocus  genetic  analysis  of  host  use,  introgression and  speciation  in host strains of fall armyworm (Lepidoptera: Noctuidae). Ann. Entomol.  Soc. Am. 97: 1034-1044.         [ Links ]

Salinas, H. 2010. Identificación de haplotipos de Spodoptera frugiperda en algunas poblaciones de Colombia para  el  estudio  del  comportamiento  migratorio  de la  especie. Tesis Maestría en Ciencias,  Universidad Nacional de Colombia, Bogotá, Colombia.         [ Links ]

Santos-Amaya,  O., O. Delgado-Restrepo, J. Argüelles & E. Aguilera-Garramuño.  2009. Evaluación del comportamiento  del complejo Spodoptera con la introducción de algodón transgénico al Tolima, Colombia. Rev. Corpoica Cienc. Tec. Agropec. 10: 24-32.         [ Links ]

Strutzenberger, P., G. Brehm, F. Bodner & K. Fiedler. 2010. Molecular phylogeny of Eois (Lepidoptera, Geometridae): evolution of wing patterns and host plant use in a species rich group of Neotropical moths. Zool. Scripta 39: 603-620.         [ Links ]

Tajima, F. 1989. Statistical method for testing neutral mutation  hypothesis  by  DNA  polymorphism.  Genetics 123: 585-595.         [ Links ]

Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei & S. Kumar. 2011. MEGA 5. Molecular evolutionary genetic analysis using  maximum likelihood, evolutionary  distance and maximum parsimony  methods. Mol. Biol. Evol. 28: 2 731-2 739.         [ Links ]

Todd, E.L. & R.W. Poole. 1980. Keys and  illustrations for  the  armyworm  moths   of   the  noctuid  genus Spodoptera  Guenée from the Western  Hemisphere. Ann. Entomol. Soc. Am. 73 : 722-738.         [ Links ]

Vélez-Arango,  A.M.,  R.E.  Arango,  D.  Villanueva,  E. Aguilera & C.I. Saldamando. 2008.  Identificación de biotipos de Spodoptera  frugiperda (Lepidoptera: Noctuidae)  mediante marcadores mitocondriales y nucleares. Rev. Col. Entomol. 34: 145-150.         [ Links ]

Wagner, D.L. 2001. Moths. Academic, Londres, Inglaterra. Watterson, G. 1975. On  the number of segregating sites in  genetical models without  recombination. Theor. Popul. Biol. 7: 256-276.         [ Links ]

Watterson, G. 1975. On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7: 256-276.         [ Links ]

Weller, S.J., D.P. Pashley, J.A. Martin & J.L.  Constable. 1994.  Phylogeny of noctuoid moths and  the utility of combining independent nuclear and mitochondrial genes. Syst. Biol. 43: 194-211.         [ Links ]

Yela, J.L. & I.J. Kitching. 1999. La filogenia de Noctuidos, repasada (Lepidoptera:  Noctuidae). Noctuid phylogeny  revisited (Lepidoptera: Noctuidae). Bol.  Soc. Entomol. Aragonesa 26: 485-520.         [ Links ]

*Correspondencia:
Clara Inés Saldamando: Universidad Nacional de Colombia, Facultad de Ciencias, Departamento de Biociencias, UNALMED, Calle 59A No 63-20. Medellín, Colombia. Edificio 11-208/ Laboratorio de Biotecnología Vegetal, Corporación para Investigaciones Biológicas  CIB-UNALMED, Cra 72 No 78B-141. Medellín, Colombia. cisaldam@unal.edu.co.
Edna Judith Marquez: Universidad Nacional de Colombia, Facultad de Ciencias, Departamento de Biociencias, UNALMED, Calle 59A No 63-20. Medellín, Colombia. Edificio 11-208/  Universidad Nacional de Colombia, Grupo de investigación en Biotecnología Animal, UNALMED, Calle 59A No 63 - 20. Medellín, Colombia. Edificio 11-208. ejmarque@unal.edu.co.
1. Universidad Nacional de Colombia, Facultad de Ciencias, Departamento de Biociencias, UNALMED, Calle 59A No 63-20. Medellín, Colombia. Edificio 11-208; cisaldam@unal.edu.co
2. Laboratorio de Biotecnología Vegetal, Corporación para Investigaciones Biológicas  CIB-UNALMED, Cra 72 No 78B-141. Medellín, Colombia.
3. Universidad Nacional de Colombia, Grupo de investigación en Biotecnología Animal, UNALMED, Calle 59A No 63 - 20. Medellín, Colombia. Edificio 11-208; ejmarque@unal.edu.co

Recibido 11-VII-2011.    Corregido 16-I-2012.    Aceptado 08-II-2012.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License